DES-Testbed, Freie Universität Research Pigeon,Plant,plasmid,Real-time High-performance liquid chromatography under partially denaturing conditions

High-performance liquid chromatography under partially denaturing conditions


des-testbed

DHPLC/SURVEYOR nuclease: a delicate, speedy and inexpensive technique to research BRCA1 and BRCA2 mutations in breast most cancers households.

Hereditary breast most cancers accounts for about 10% of all breast cancers and BRCA1 and BRCA2 genes have been recognized as validated susceptibility genes for this pathology. Testing for BRCA gene mutations is normally based mostly on a pre-screening strategy, such because the partial denaturation DHPLC technique, and capillary direct sequencing. Nevertheless, this strategy is time consuming as a result of massive measurement of BRCA1 and BRCA2 genes. Just lately, a brand new low price and time saving DHPLC protocol has been developed to research gene mutations through the use of SURVEYOR(®) Nuclease digestion and DHPLC evaluation. A subset of 90 sufferers, enrolled within the Genetic Counseling Program of the Nationwide Most cancers Centre of Bari (Italy), was carried out to validate this strategy.

Earlier retrospective evaluation confirmed that 9/90 sufferers (10%) had been mutated in BRCA1 and BRCA2 genes and these information had been confirmed by the current strategy. DNA samples underwent landing PCR and, subsequently, SURVEYOR(®) nuclease digestion. BRCA1 and BRCA2 amplicons had been divided into teams relying on amplicon measurement to permit multiamplicon digestion. The product of this response had been analyzed on Transgenomic WAVE Nucleic Acid Excessive Sensitivity Fragment Evaluation System. The operator who carried out the DHPLC surveyor strategy didn’t know the sequencing outcomes at the moment. The SURVEYOR(®) Nuclease DHPLC strategy was in a position to detect all alterations with a sensitivity of 95%. Moreover, with a purpose to save time and reagents, a multiamplicon setting preparation was validated.

des-testbed

des-testbed

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

DLR-MYH1-Hu-96T 96T
EUR 621
  • Should the Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RDR-MYH1-Hu-48Tests 48 Tests
EUR 500

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RDR-MYH1-Hu-96Tests 96 Tests
EUR 692

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RD-MYH1-Hu-48Tests 48 Tests
EUR 478

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RD-MYH1-Hu-96Tests 96 Tests
EUR 662

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

DLR-MYH1-Mu-48T 48T
EUR 489
  • Should the Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

DLR-MYH1-Mu-96T 96T
EUR 635
  • Should the Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RDR-MYH1-Mu-48Tests 48 Tests
EUR 511

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RDR-MYH1-Mu-96Tests 96 Tests
EUR 709

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RD-MYH1-Mu-48Tests 48 Tests
EUR 489

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RD-MYH1-Mu-96Tests 96 Tests
EUR 677

Human Myosin 1(MYH1) ELISA kit

E01M0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Myosin 1(MYH1) ELISA kit

E01M0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Myosin 1(MYH1) ELISA kit

E01M0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human MYH1/ Myosin-1 ELISA Kit

E1687Hu 1 Kit
EUR 571

Human MYH1(Myosin-1) ELISA Kit

EH0735 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P12882
  • Alias: MYH1(Myosin Heavy Chain 1, Skeletal Muscle, Adult)/Myosin-1/Myosin heavy chain 1/Myosin heavy chain 2x(MyHC-2x)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Pig MYH1/ Myosin-1 ELISA Kit

E0133Pi 1 Kit
EUR 717

Bovine MYH1/ Myosin-1 ELISA Kit

E0186Bo 1 Kit
EUR 717

Rat Myosin 1(MYH1) ELISA kit

E02M0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Myosin 1(MYH1) ELISA kit

E02M0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Myosin 1(MYH1) ELISA kit

E02M0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myosin 1(MYH1) ELISA kit

E04M0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myosin 1(MYH1) ELISA kit

E04M0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myosin 1(MYH1) ELISA kit

E04M0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Myosin 1(MYH1) ELISA kit

E03M0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Myosin 1(MYH1) ELISA kit

E03M0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Myosin 1(MYH1) ELISA kit

E03M0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Myosin 1(MYH1) ELISA kit

E06M0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Myosin 1(MYH1) ELISA kit

E06M0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Myosin 1(MYH1) ELISA kit

E06M0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Myosin 1(MYH1) ELISA kit

E08M0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Myosin 1(MYH1) ELISA kit

E08M0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Myosin 1(MYH1) ELISA kit

E08M0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Myosin 1(MYH1) ELISA kit

E07M0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Myosin 1(MYH1) ELISA kit

E07M0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Myosin 1(MYH1) ELISA kit

E07M0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Myosin 1(MYH1) ELISA kit

E09M0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Myosin 1(MYH1) ELISA kit

E09M0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Myosin 1(MYH1) ELISA kit

E09M0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1)

4-RPA754Hu01
  • EUR 481.70
  • EUR 232.00
  • EUR 1531.36
  • EUR 577.12
  • EUR 1054.24
  • EUR 385.00
  • EUR 3678.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P12882
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.0kDa
  • Isoelectric Point: 9.6
Description: Recombinant Human Myosin Heavy Chain 1, Skeletal Muscle, Adult expressed in: E.coli

Recombinant Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1)

4-RPA754Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5SX40
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.5kDa
  • Isoelectric Point: 5.6
Description: Recombinant Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult expressed in: E.coli

Guinea pig Myosin 1(MYH1) ELISA kit

E05M0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Myosin 1(MYH1) ELISA kit

E05M0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Myosin 1(MYH1) ELISA kit

E05M0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Myosin heavy polypeptide 1 (MYH1) polyclonal antibody

ABP-PAB-01616 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

ELISA kit for Bovine Myosin-1 (MYH1)

KTE10236-48T 48T
EUR 354
  • Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosi
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Myosin-1 (MYH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Myosin-1 (MYH1)

KTE10236-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosi
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Myosin-1 (MYH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Myosin-1 (MYH1)

KTE10236-96T 96T
EUR 572
  • Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosi
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Myosin-1 (MYH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Myosin-1 (MYH1)

KTE20052-48T 48T
EUR 354
  • Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosi
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Myosin-1 (MYH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Myosin-1 (MYH1)

KTE20052-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosi
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Myosin-1 (MYH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Myosin-1 (MYH1)

KTE20052-96T 96T
EUR 572
  • Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosi
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Myosin-1 (MYH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Protein

20-abx168162
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody

20-abx005265
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody

20-abx177671
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody

20-abx212233
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody

20-abx212641
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody

20-abx104339
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody

20-abx128730
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody

20-abx173673
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody

20-abx320249
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody

abx235469-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody

abx235470-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx053857-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

20-abx152417
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx253693-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx570236-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) CLIA Kit

20-abx491987
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult(MYH1)ELISA Kit

QY-E03032 96T
EUR 361

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

SEA754Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

SEA754Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

SEA754Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

SEA754Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

4-SEA754Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Myosin Heavy Chain 1, Skeletal Muscle, Adult elisa. Alternative names of the recognized antigen: MYHSA1
  • MYHa
  • MyHC-2X/D
  • Myosin-1
  • Myosin Heavy Chain IIx/d
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Protein

20-abx068140
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody (FITC)

20-abx271252
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody (Biotin)

20-abx271518
  • EUR 425.00
  • EUR 230.00
  • EUR 1219.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody Pair

20-abx370650
  • EUR 1622.00
  • EUR 1038.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Recombinant Treponema pallidum p15 (partial)

7-07552 100µg Ask for price

Recombinant Treponema pallidum p15 (partial)

7-07553 500µg Ask for price

Recombinant Treponema pallidum p15 (partial)

7-07554 1000µg Ask for price

Recombinant Treponema pallidum p17 (Partial)

7-07564 100µg Ask for price

Recombinant Treponema pallidum p17 (Partial)

7-07565 500µg Ask for price

Recombinant Treponema pallidum p17 (Partial)

7-07566 1000µg Ask for price

Recombinant Treponema pallidum p47 (Partial)

7-07576 100µg Ask for price

Recombinant Treponema pallidum p47 (Partial)

7-07577 500µg Ask for price

Recombinant Treponema pallidum p47 (Partial)

7-07578 1000µg Ask for price

Recombinant Treponema pallidum TmpA (Partial)

7-07579 100µg Ask for price

Recombinant Treponema pallidum TmpA (Partial)

7-07580 500µg Ask for price

Recombinant Treponema pallidum TmpA (Partial)

7-07581 1000µg Ask for price

MYL5 Myosin Light Chain 5 (1-173 a.a.) Human Recombinant Protein

PROTQ02045-1 Regular: 10ug
EUR 317
Description: _x000D_ MYL5 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 197 amino acids (1-173 a.a.) and having a molecular mass of 22.1kDa.;MYL5 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

ELISA kit for Human MYH1 (Myosin Heavy Chain 1, Skeletal Muscle, Adult)

E-EL-H1430 1 plate of 96 wells
EUR 534
  • Gentaur's MYH1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MYH1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MYH1 (Myosin Heavy Chain 1, Skeletal Muscle, Adult) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human MYH1 (Myosin Heavy Chain 1, Skeletal Muscle, Adult)

ELK2107 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated ant
  • Show more
Description: A sandwich ELISA kit for detection of Myosin Heavy Chain 1, Skeletal Muscle, Adult from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig)

4-PAA754Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (Tyr585~Ala794)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1)

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

20-abx154425
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx360530-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx359028-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx355635-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx363586-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx364394-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx574492-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

20-abx585038
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) CLIA Kit

20-abx491988
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) CLIA Kit

20-abx496355
  • EUR 7645.00
  • EUR 4074.00
  • EUR 942.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Cow Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx512024-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx512025-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx512028-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse)

4-PAA754Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1)

Rat Myosin Heavy Chain 1, Skeletal Muscle, Adult(MYH1)ELISA kit

QY-E10228 96T
EUR 361

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

SEA754Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

SEA754Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

SEA754Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

SEA754Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

4-SEA754Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Myosin Heavy Chain 1, Skeletal Muscle, Adult elisa. Alternative names of the recognized antigen: MYHSA1
  • MYHa
  • MyHC-2X/D
  • Myosin-1
  • Myosin Heavy Chain IIx/d
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult(MYH1)ELISA kit

QY-E21041 96T
EUR 361

RVG protein, partial

80-1580 500 ug
EUR 1425
Description: Recombinant Rabies virus Glycoprotein(G), partial

IL6R (partial) Peptide

20-abx266289
  • EUR 495.00
  • EUR 815.00
  • EUR 356.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), APC

4-PAA754Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (Tyr585~Ala794)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with APC.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), Biotinylated

4-PAA754Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (Tyr585~Ala794)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with Biotin.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), Cy3

4-PAA754Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (Tyr585~Ala794)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with Cy3.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), FITC

4-PAA754Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (Tyr585~Ala794)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with FITC.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), HRP

4-PAA754Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (Tyr585~Ala794)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with HRP.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), PE

4-PAA754Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (Tyr585~Ala794)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with PE.

Recombinant (E.Coli) Treponema pallidum p17 (Partial)

RP-1442 100 ug
EUR 286

Recombinant (E.Coli) Treponema pallidum p47 ( partial)

RP-1444 100 ug
EUR 286

Recombinant (E.Coli) Treponema pallidum TmpA (partial)

RP-1446 100 ug
EUR 286

Recombinant (E.Coli) Treponema pallidum p15 (partial)

RP-1452 100 ug
EUR 286

ELISA kit for Mouse MYH1 (Myosin Heavy Chain 1, Skeletal Muscle, Adult)

ELK2108 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated ant
  • Show more
Description: A sandwich ELISA kit for detection of Myosin Heavy Chain 1, Skeletal Muscle, Adult from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

abx357674-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), APC

4-PAA754Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with APC.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), Biotinylated

4-PAA754Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with Biotin.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), Cy3

4-PAA754Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with Cy3.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), FITC

4-PAA754Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with FITC.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), HRP

4-PAA754Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with HRP.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), PE

4-PAA754Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with PE.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), APC-Cy7

4-PAA754Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (Tyr585~Ala794)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with APC-Cy7.

MYH1 Antibody

35828-100ul 100ul
EUR 252

MYH1 Antibody

31804-100ul 100ul
EUR 252

MYH1 Antibody

1-CSB-PA877584
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MYH1 Antibody

1-CSB-PA791340
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

MYH1 Antibody

1-CSB-PA015289ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MYH1 antibody

70R-3929 50 ug
EUR 467
Description: Rabbit polyclonal MYH1 antibody raised against the N terminal of MYH1

MYH1 siRNA

20-abx925144
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYH1 siRNA

20-abx925145
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Recombinant Treponema pallidum p15 (Partial), His Tag

7-07558 100µg Ask for price

Recombinant Treponema pallidum p15 (Partial), His Tag

7-07559 500µg Ask for price

Recombinant Treponema pallidum p15 (Partial), His Tag

7-07560 1000µg Ask for price

Recombinant Human Myosin Light Chain 1

7-05632 2µg Ask for price

Recombinant Human Myosin Light Chain 1

7-05633 10µg Ask for price

Recombinant Human Myosin Light Chain 1

7-05634 1mg Ask for price

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAA754Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with APC-Cy7.

Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

WEA754Mu-10x96wellstestplate 10x96-wells test plate
EUR 4181.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

WEA754Mu-1x48wellstestplate 1x48-wells test plate
EUR 432.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

WEA754Mu-1x96wellstestplate 1x96-wells test plate
EUR 574.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

WEA754Mu-5x96wellstestplate 5x96-wells test plate
EUR 2284.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

4-WEA754Mu
  • EUR 4232.00
  • EUR 2235.00
  • EUR 575.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Myosin Heavy Chain 1, Skeletal Muscle, Adult elisa. Alternative names of the recognized antigen: MYHSA1
  • MYHa
  • MyHC-2X/D
  • Myosin-1
  • Myosin Heavy Chain IIx/d
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Interleukin-6 Receptor (partial)

5-01403 4 x 5mg Ask for price

Anti-Myosin VI Antibody

A02627-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Myosin VI Antibody (MYO6) detection.tested for IHC, WB in Human, Mouse, Rat.

Human MYH1 ELISA Kit

ELA-E0161h 96 Tests
EUR 824

MYH1 ELISA KIT|Human

EF000470 96 Tests
EUR 689

Human MYH1 shRNA Plasmid

20-abx953047
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant human Myosin-6

P1315 100ug Ask for price
  • Uniprot ID: P13533
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Myosin-6

Recombinant human Myosin-6

P1499 100ug Ask for price
  • Uniprot ID: P13533
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Myosin-6

Recombinant human Myosin-11

P2913 100ug Ask for price
  • Uniprot ID: P35749
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Myosin-11

Recombinant human Myosin-4

P2914 100ug Ask for price
  • Uniprot ID: Q9Y623
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Myosin-4

MYH1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1373702 1.0 ug DNA
EUR 154

Recombinant (E.Coli) Treponema pallidum p15 (Partial), His-tag

RP-1448 100 ug
EUR 286

Anti-MYO1D/Myosin Id Antibody

A09126-1 100ul
EUR 397
Description: Rabbit Polyclonal MYO1D/Myosin Id Antibody. Validated in IHC and tested in Human, Mouse, Rat.

MYH1 Blocking Peptide

33R-4695 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYH1 antibody, catalog no. 70R-3929

MYH1 Conjugated Antibody

C31804 100ul
EUR 397

MYH1 Conjugated Antibody

C35828 100ul
EUR 397

MYH1 cloning plasmid

CSB-CL015289HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5820
  • Sequence: ATGAGTTCTGACTCTGAGATGGCCATTTTTGGGGAGGCTGCTCCTTTCCTCCGAAAGTCTGAAAGGGAGCGAATTGAAGCCCAGAACAAGCCTTTTGATGCCAAGACATCAGTCTTTGTGGTGGACCCTAAGGAGTCCTTTGTGAAAGCAACAGTGCAGAGCAGGGAAGGGGGGA
  • Show more
Description: A cloning plasmid for the MYH1 gene.

MYH1 Rabbit pAb

A6935-100ul 100 ul
EUR 308

MYH1 Rabbit pAb

A6935-200ul 200 ul
EUR 459

MYH1 Rabbit pAb

A6935-20ul 20 ul
EUR 183

MYH1 Rabbit pAb

A6935-50ul 50 ul
EUR 223

MYH1 Polyclonal Antibody

ABP59360-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MYH1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

MYH1 Polyclonal Antibody

ABP59360-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MYH1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

MYH1 Polyclonal Antibody

ABP59360-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYH1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

MYH1 Polyclonal Antibody

ES11981-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MYH1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYH1 Polyclonal Antibody

ES11981-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYH1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- MYH1 antibody

FNab05469 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: myosin, heavy chain 1, skeletal muscle, adult
  • Uniprot ID: P12882
  • Gene ID: 4619
  • Research Area: Cancer, Immunology, Developmental biology
Description: Antibody raised against MYH1

anti- MYH1 antibody

FNab05470 100µg
EUR 548.75
  • Immunogen: myosin, heavy chain 1, skeletal muscle, adult
  • Uniprot ID: P12882
  • Gene ID: 4619
  • Research Area: Cancer, Immunology, Developmental biology
Description: Antibody raised against MYH1

Anti-MYH1 antibody

PAab05469 100 ug
EUR 412

Anti-MYH1 antibody

PAab05470 100 ug
EUR 386

Anti-MYH1 antibody

STJ29015 100 µl
EUR 277
Description: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development.

Anti-MYH1 antibody

STJ193139 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MYH1

Identification of copy quantity variation of CAPN10 in Thais with sort 2 diabetes by multiplex PCR and denaturing excessive efficiency liquid chromatography (DHPLC).

 

Copy quantity variations (CNVs) have been proven to be related to a number of ailments. They’ll trigger deviation of genotypes from Hardy-Weinberg Equilibrium (HWE). Genetic case-control affiliation research in Thais revealed that genotype distribution of CAPN10 Indel19 was deviated from HWE after correction of genotyping error. Due to this fact, we goal to determine CNVs inside CAPN10 Indel19 area. The semi-quantitative denaturating excessive efficiency liquid chromatography (DHPLC) technique was used to detect CNVs within the area of CAPN10 Indel19 marker in cohort of 305 sufferers with sort 2 diabetes and 250 management topics with out diabetes. CNVs within the area of CAPN10 Indel19 was efficiently detected by DHPLC.

After correction of genotype calling based mostly on the standing of recognized CNVs, CAPN10 Indel19 genotypes had been well-fitted for HWE (p>0.05). Nevertheless, we didn’t discover affiliation between CNV genotypes and danger of sort 2 diabetes in our inhabitants. CNVs in CAPN10 have been recognized in Thais. These CNVs result in deviation from HWE of CAPN10 Indel19 genotypes. After excluding recognized CNVs from the evaluation, CAPN10 Indel19 was related to sort 2 diabetes. The knowledge obtained from our examine could be useful for genotyping accuracies of SNPs residing within the CNVs area.

 

Excessive-performance liquid chromatography underneath partially denaturing situations (dHPLC) is a quick and cost-effective technique for screening molecular defects: 4 novel mutations present in X-linked persistent granulomatous illness.

 

Implementing exact methods in routine analysis of persistent granulomatous illness (CGD), which expedite the screening of molecular defects, could also be essential for a fast assumption of affected person prognosis. This examine in contrast the efficacy of single-strand conformation polymorphism evaluation (SSCP) and high-performance liquid chromatography underneath partially denaturing situations (dHPLC) for screening mutations in CGD sufferers. We chosen 10 male CGD sufferers with a medical historical past of extreme recurrent infections and irregular respiratory burst operate. gDNA, mRNA and cDNA samples had been ready by customary strategies. CYBB exons had been amplified by PCR and screened by SSCP or dHPLC. Irregular DNA fragments had been sequenced to disclose the character of the mutations.

The SSCP and dHPLC strategies confirmed DNA abnormalities, respectively, in 55% and 100% of the instances. Sequencing of the irregular DNA samples confirmed mutations in all instances. 4 novel mutations in CYBB had been recognized which had been picked up solely by the dHPLC screening (c.904 insC, c.141+5 g>t, c.553 T>C, and c.665 A>T). This work highlights the relevance of dHPLC, a delicate, quick, dependable and cost-effective technique for screening mutations in CGD, which together with practical assays assessing the phagocyte respiratory burst will contribute to expedite the definitive analysis of X-linked CGD, direct therapy, genetic counselling and to have a transparent assumption of the prognosis. This technique is very appropriate for growing nations.

 

dHPLC effectivity for semi-automated cDNA-AFLP analyses and fragment assortment within the apple scab-resistance gene mannequin.

 

cDNA-AFLP evaluation for transcript profiling has been efficiently utilized to check many plant organic techniques, notably plant-microbe interactions. Nevertheless, the separation of cDNA-AFLP fragments by gel electrophoresis is reported to be labor-intensive with solely restricted potential for automation, and the gathering of differential bands for gene identification is much more cumbersome.

On this work, we current using dHPLC (denaturing excessive efficiency liquid chromatography) and automatic DNA fragment assortment utilizing the WAVE(®) System to research and recuperate cDNA-AFLP fragments.

The tactic is efficiently utilized to the Malus-Venturia inaequalis interplay, making it potential to gather 66 totally different transcript-derived fragments for apple genes putatively concerned within the protection response activated by the HcrVf2 resistance gene.

The outcomes, validated by actual time quantitative RT-PCR, had been in keeping with the plant-pathogen interplay underneath investigation and this additional helps the suitability of dHPLC for cDNA-AFLP transcript profiling. Options and benefits of this new strategy are mentioned, evincing that it’s an nearly absolutely automatable and cost-effective resolution for processing massive numbers of samples and gathering differential genes concerned in different organic processes and non-model vegetation.

The usage of DHPLC (Denaturing Excessive Efficiency Liquid Chromatography) in II degree screening of the CFTR gene in Prenatal Analysis.

 

OBJECTIVE

The goal of the examine is to judge the function of Denaturing Excessive Efficiency Liquid Chromatography (DHPLC) within the second degree screening of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.

 

METHODS

A 9-month potential examine, between June 2008 and March 2009 at Artemisia Fetal Medical Centre, included 3829 samples of amniotic fluid collected from ladies present process mid-trimester amniocentesis.The genetic analysis of CF was based mostly on analysis of the primary mutations of the CFTR gene on fetal DNA extracted from the amniocytes, (first degree screening) utilizing totally different business diagnostic techniques. A second degree screening utilizing DHPLC, on the amniotic fluid and on a blood pattern from the couple, was supplied in case of fetuses heterozygous at first degree screening.

 

RESULTS

Of 3829 fetuses, 134 had been discovered to be constructive, 129 heterozygous and 5 affected. Of the 129 {couples}, following acceptable genetic counselling, 53 requested a second degree screening. By way of using DHPLC, 44 {couples} had been discovered to be adverse, and in 9 {couples}, 9 uncommon mutations had been recognized.

 

CONCLUSIONS

The primary degree screening could be helpful to proof as much as 75% of the CF mutations. The second degree screening can determine an additional 10% of mutant alleles. DHPLC was discovered to be a dependable and particular technique for the speedy identification of the uncommon CFTR mutations which weren’t revealed in preliminary first degree screening.

Leave a Reply

Your email address will not be published. Required fields are marked *